Thraustochytrium mitochondrial code
The thraustochytrium mitochondrial code (translation table 23) is a genetic code found in the mitochondria of labyrinthulid Thraustochytrium aureum. The mitochondrial genome was sequenced by the Organelle Genome Megasequencing Program.
Code
AAs = FF*LSSSSYY**CC*WLLLLPPPPHHQQRRRRIIIMTTTTNNKKSSRRVVVVAAAADDEEGGGGStarts = --------------------------------M--M---------------M------------Base1 = TTTTTTTTTTTTTTTTCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAGGGGGGGGGGGGGGGGBase2 = TTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGTTTTCCCCAAAAGGGGBase3 = TCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAGTCAG
Bases: adenine (A), cytosine (C), guanine (G) and thymine (T) or uracil (U).
Amino acids: Alanine (Ala, A), Arginine (Arg, R), Asparagine (Asn, N), Aspartic acid (Asp, D), Cysteine (Cys, C), Glutamic acid (Glu, E), Glutamine (Gln, Q), Glycine (Gly, G), Histidine (His, H), Isoleucine (Ile, I), Leucine (Leu, L), Lysine (Lys, K), Methionine (Met, M), Phenylalanine (Phe, F), Proline (Pro, P), Serine (Ser, S), Threonine (Thr, T), Tryptophan (Trp, W), Tyrosine (Tyr, Y), Valine (Val, V)
Differences from the standard code
It is the similar to the bacterial code (translation table 11) but it contains an additional stop codon (TTA) and also has a different set of start codons.
Systematic range and comments
- Mitochondira of Thraustochytrium aureum.
See also
References
- This article contains public domain text from the NCBI page compiled by Andrzej (Anjay) Elzanowski and Jim Ostell.[1]
- ↑ "The Genetic Codes". Retrieved 11 August 2016.